View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5646-Insertion-8 (Length: 340)
Name: NF5646-Insertion-8
Description: NF5646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5646-Insertion-8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 306; Significance: 1e-172; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 8 - 337
Target Start/End: Complemental strand, 10462151 - 10461822
Alignment:
| Q |
8 |
tccttcacgtctgcagaggtggttacagtcatcaaactagaatcaaccaagggtaaaagttccgacattgtttcttgtttctttgcagggggtatctcat |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
10462151 |
tccttcacgtctgcagaggtggttatagtcatcaaactagaatcaaccaagggtaacagttccgacattgtttctggtttctttgcagggggtacctcat |
10462052 |
T |
|
| Q |
108 |
tagggtttccactgttgtcgatggaacgcttgcttccagatttgaacactagtcctgcggttagggtttggggtttagggttagattgaacaacttcttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10462051 |
tagggtttccactgttgtcgatggaacgcttgcttccagatttgaacactagtcctgcggttagggtttgaggtttagggttagattgaacaacttcttt |
10461952 |
T |
|
| Q |
208 |
atcagaaggtaagtattcatcattagaagttgagtattcatcgaaagatgagggtttgacagttagggttttgggtttagggttagattgagcaacttct |
307 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461951 |
atcagaaggtaagtattcatcatcagaagttgagtattcatcgaaagatgagggtttgacagttagggttttgggtttagggttagattgagcaacttct |
10461852 |
T |
|
| Q |
308 |
tcatcggaagatgagtctgtggattcatac |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10461851 |
tcatcggaagatgagtctgtggattcatac |
10461822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 63
Target Start/End: Original strand, 10539973 - 10540029
Alignment:
| Q |
8 |
tccttcacgtctgcagagg-tggttacagtcatcaaactagaatcaaccaagggtaa |
63 |
Q |
| |
|
|||||||||||||||| || ||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
10539973 |
tccttcacgtctgcagggggtggttgcagaaatcaaactagaatcaaccaatggtaa |
10540029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University