View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5646_high_5 (Length: 232)
Name: NF5646_high_5
Description: NF5646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5646_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 41 - 217
Target Start/End: Complemental strand, 32744710 - 32744534
Alignment:
| Q |
41 |
aataccaacaccatgttgttgatggattcgaggggtggtaagaaatattttattacttaaaagtataaaatgttgattgtttggatactagatgtgatga |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32744710 |
aataccaacaccatgttgttgatggattcgaggggtggtaagaaatattttattatttaaaagtataaaatgttgattgtttggatactagatgtgatga |
32744611 |
T |
|
| Q |
141 |
attttagtttagcttcggaaatattgtgtgaactatgaagatgttatgttatacttcagacttcagagagatgagaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32744610 |
attttagtttagcttcggaaatattgtgtgaactataaagatgttatgttatacttcagacttcagagagatgagaa |
32744534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University