View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5646_low_2 (Length: 301)
Name: NF5646_low_2
Description: NF5646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5646_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 1e-75; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 120 - 267
Target Start/End: Complemental strand, 26395090 - 26394943
Alignment:
| Q |
120 |
ttggcataatatactgcggtatcatgtaaattattttgtcttaattacattaataatgaatattgatgtaccatgttacttacaattatttcagattcaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26395090 |
ttggcataatatactgcggtatcatgtaaattattttgtcttaattacattaataatgaatattgatgtaccatattacttacaattatttcagattcaa |
26394991 |
T |
 |
| Q |
220 |
caaatcatacatgaatattctattataaatgagattttaacacccctt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26394990 |
caaatcatacatgaatattctattataaatgagattttaacacccctt |
26394943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 25 - 129
Target Start/End: Complemental strand, 26398915 - 26398811
Alignment:
| Q |
25 |
ttacaattgatcctttcnnnnnnntattgtgttcaattgatattcgtcgacagtcattttggcctagttgattgaacgctcatttattaatgattttggc |
124 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26398915 |
ttacaattgatcctttcaaaaaaatattgtgttcaattgatattcgtcgacagtcattttggcctagttgattgaacgctcatttattaatgattttggc |
26398816 |
T |
 |
| Q |
125 |
ataat |
129 |
Q |
| |
|
||||| |
|
|
| T |
26398815 |
ataat |
26398811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 94 - 130
Target Start/End: Complemental strand, 26385411 - 26385375
Alignment:
| Q |
94 |
gattgaacgctcatttattaatgattttggcataata |
130 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
26385411 |
gattgaaggctcatttattaatgattttggcctaata |
26385375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University