View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5647_low_2 (Length: 285)
Name: NF5647_low_2
Description: NF5647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5647_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 17 - 186
Target Start/End: Complemental strand, 32094741 - 32094572
Alignment:
| Q |
17 |
ttggaacttcgtgtctgctctttgaggtaaaaatacgccagtaccgcatgatccatgacttgattctaaaaatatcgctcgcattccgtttccaatgcca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32094741 |
ttggaacttcgtgtctgctctttgaggtaaaaatacgcctgtaccgcatgatccatgacttgattctaaaaatattgctcgcattccgtttccaatgcca |
32094642 |
T |
|
| Q |
117 |
cggttcccaagttttggcttttggtacaaagatcctgacatggattttgagtactgcacaagacattttg |
186 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32094641 |
cggttcgtaagttttggcttttggtacaaagatcctgacatggattttgagtactgcacaagacattttg |
32094572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University