View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5649_high_11 (Length: 282)
Name: NF5649_high_11
Description: NF5649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5649_high_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 108 - 266
Target Start/End: Original strand, 25933809 - 25933967
Alignment:
| Q |
108 |
ggaggaatctgtgcttactgtcttaaagaacgtttggttaagcttgtgtgttcagattgtggagaacaaaggctttcttcttgttcttgctctgatgaga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933809 |
ggaggaatctgtgcttactgtcttaaagaacgtttggtcaagcttgtgtgttcagattgtggagaacaaaggctttcttcttgttcttgctctgatgaga |
25933908 |
T |
|
| Q |
208 |
tcacttcgaatcgaaattcatgctctgttgaagtaggaagtgttggaagagtttcattt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
25933909 |
tcacttcgaatcgaaattcatgctctgttgaggtaggaagtgttggaagagtctcattt |
25933967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 135 - 266
Target Start/End: Complemental strand, 16704248 - 16704117
Alignment:
| Q |
135 |
gaacgtttggttaagcttgtgtgttcagattgtggagaacaaaggctttcttcttgttcttgctctgatgagatcacttcgaatcgaaattcatgctctg |
234 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | || |
|
|
| T |
16704248 |
gaacgtttggtcaagctagtgtgttcagattgtggggaacaaaggctttcttcttgttcttgctctgatgagatcacttccaatcgaaattcatgttatg |
16704149 |
T |
|
| Q |
235 |
ttgaagtaggaagtgttggaagagtttcattt |
266 |
Q |
| |
|
|||| ||||||||| |||| ||||| |||||| |
|
|
| T |
16704148 |
ttgaggtaggaagtattggcagagtctcattt |
16704117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 25933703 - 25933785
Alignment:
| Q |
5 |
gagaagcaaaggtgttgaagcttatagcaatgacatggattgctactattctacttctgattttcttccatgtaagaagcatc |
87 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933703 |
gagaaacaaaggtgttgaagcttatagcaatgacatggattgctactattctacttctgattttcttccatgtaagaagcatc |
25933785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 132 - 266
Target Start/End: Original strand, 14999626 - 14999760
Alignment:
| Q |
132 |
aaagaacgtttggttaagcttgtgtgttcagattgtggagaacaaaggctttcttcttgttcttgctctgatgagatcacttcgaatcgaaattcatgct |
231 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14999626 |
aaagaacgtttggtcaagcttgtgtgttcagattgtggggaacaaaggctttcttcttgttcttgctctgatgagatcacttccaatcgaaattcatgct |
14999725 |
T |
|
| Q |
232 |
ctgttgaagtaggaagtgttggaagagtttcattt |
266 |
Q |
| |
|
| |||| ||||||||| |||| ||||| |||||| |
|
|
| T |
14999726 |
attttgaggtaggaagtattggcagagtctcattt |
14999760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University