View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5649_low_1 (Length: 465)
Name: NF5649_low_1
Description: NF5649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5649_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 421; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 421; E-Value: 0
Query Start/End: Original strand, 18 - 450
Target Start/End: Complemental strand, 30184940 - 30184508
Alignment:
| Q |
18 |
tatcaagtatcgtatctgagcattgtcattggcaaaatcagcccaacaaccaaacagaaccagagccagagccttagactctgaatctccactgttgaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30184940 |
tatcaagtatcgtatctgagcattgtcattggcaaaatcagcccaacaaccaaacagaaccagagccagagccttagactctgaatctccactgttgaaa |
30184841 |
T |
|
| Q |
118 |
acagatttcacccgcttcaacaactccagatggttagctactctggccactgacagcaaccctttacactgcttgtgcttcctgttatcatggtgctttc |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30184840 |
acagatttcacctgcttcaacaactccagatggttagctactctggccactgacagcaaccctttacactgcttgtgcttcctgttatcatggtgctttc |
30184741 |
T |
|
| Q |
218 |
tctcgatcaagaaaactctgacaacagaaagcctgatttctgtgttgcctcctctaaatgcatcagcaaggcgtaagaggattgtattagcaaatagttc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30184740 |
tctcgatcaagaaaactctgacaacagaaagcctgatttctgtgttgcctcccctaaatgcatcagcaaggcgtaagaggattgtattagcaaatagttc |
30184641 |
T |
|
| Q |
318 |
atcctcacccggcacaaggccaaacatgccattggaaacaataccagactcaagctctctactccaacgctgaaggtgggggcccatttgcaatattgct |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30184640 |
atcctcacccggcacaaggccaaacatgccattggaaacaataccagactcaagctctctactccaacgctgaaggtgggggcccatttgcaatatggct |
30184541 |
T |
|
| Q |
418 |
ttgacaggtacacctgatgaaaaataagacttg |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30184540 |
ttgacaggtacacctgatgaaaaataagacttg |
30184508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University