View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5649_low_13 (Length: 258)
Name: NF5649_low_13
Description: NF5649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5649_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 1988634 - 1988414
Alignment:
| Q |
16 |
cattagtaacttcactctccaacgtgacgtaaacagaaacatattcagacttatcctgcggattcttgccgtcgggatagaagtagattgcccattcata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1988634 |
cattagtaacttcactctccaacgtgacgtaaacagaaacaaattcagacttatcctgcggattcttgccgtcgggatagaagtagattgcccattcata |
1988535 |
T |
 |
| Q |
116 |
ccctccggcggtgaaaacgtcgcttgcaatgtgttttccgattcccattcccttggtcagtgagtagccttcgatcaagaattcgtgtgaggcgtttgtt |
215 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1988534 |
ccctccgccggtgaaaacttcgcttgcaatgtgttttccgattcccattcccttggtcagtgagtagccttcgatcaagaattcgtgtgaggcgtttgtt |
1988435 |
T |
 |
| Q |
216 |
gttgaaagcgaagagaatgac |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1988434 |
gttgaaagcgaagagaatgac |
1988414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 25 - 198
Target Start/End: Complemental strand, 37917684 - 37917511
Alignment:
| Q |
25 |
cttcactctccaacgtgacgtaaacagaaacatattcagacttatcctgcggattcttgccgtcgggatagaagtagattgcccattcataccctccggc |
124 |
Q |
| |
|
|||||||| |||||| || | |||| |||||||| |||| ||||||| ||||||||| || ||||||||||||||||| ||||| | |||||||||| | |
|
|
| T |
37917684 |
cttcactcgccaacgcgatgaaaaccgaaacatacgcagaattatcctccggattcttcccatcgggatagaagtagatcgcccactgataccctccgac |
37917585 |
T |
 |
| Q |
125 |
ggtgaaaacgtcgcttgcaatgtgttttccgattcccattcccttggtcagtgagtagccttcgatcaagaatt |
198 |
Q |
| |
|
||||||||| |||||||||||||||||||| | ||||||||||| | || ||||| |||| ||||||||||| |
|
|
| T |
37917584 |
ggtgaaaacatcgcttgcaatgtgttttccaacccccattcccttcgcaagcgagtacccttggatcaagaatt |
37917511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 186
Target Start/End: Complemental strand, 33578769 - 33578629
Alignment:
| Q |
46 |
aaacagaaacatattcagacttatcctgcggattcttgccgtcgggatagaagtagattgcccattcataccctccggcggtgaaaacgtcgcttgcaat |
145 |
Q |
| |
|
||||||||||||| |||| ||||| | || || || |||||||| |||||||| |||||||||| || || ||| |||||||| ||||| || || |
|
|
| T |
33578769 |
aaacagaaacataagcagaattatcttctgggtttttaccgtcggggtagaagtaaattgcccattggtaaccgccgacggtgaaagtctcgctggctat |
33578670 |
T |
 |
| Q |
146 |
gtgttttccgattcccattcccttggtcagtgagtagcctt |
186 |
Q |
| |
|
|||||| || | ||||||||| || | ||||||||||||| |
|
|
| T |
33578669 |
gtgtttaccaactcccattccttttgcaagtgagtagcctt |
33578629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University