View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5649_low_17 (Length: 234)
Name: NF5649_low_17
Description: NF5649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5649_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 65 - 217
Target Start/End: Complemental strand, 5698363 - 5698209
Alignment:
| Q |
65 |
ttaaaaatcagactttttggtccttatagtatcacatttattggcattttaccccaacagtgatgattttatgtgttaattttgattttgaatagaaaac |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5698363 |
ttaaaaatcagactttttggtccttatagtatcacatttattggcattttaccccagcagtgatgattttatgtgttaattttgattttgaataaaaaac |
5698264 |
T |
 |
| Q |
165 |
a--ccacttttgaggtaaacaaaagtcatcacttttggataaaagtttatattct |
217 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5698263 |
acgccacttttgaggtaaacaaaagtcatcacttttggataaaaatttatattct |
5698209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 5698399 - 5698367
Alignment:
| Q |
1 |
cttctactttatctcactcaaaaatatttcatt |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5698399 |
cttctactttatctcactcaaaaatatttcatt |
5698367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University