View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5650_high_11 (Length: 244)
Name: NF5650_high_11
Description: NF5650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5650_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 49 - 229
Target Start/End: Original strand, 2808717 - 2808898
Alignment:
| Q |
49 |
ttagggccggcttattggagagggagaaaacacatatgtaataaacatactattgagtcgcgaaaaaggtcac-acaatacgagttaccgaaataaatgt |
147 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||||||||| |||||| |
|
|
| T |
2808717 |
ttagggccgacttgatggagagggagaaaacacatatgtaataaacatactattaagtcgcgaaaaaggtcaccacaataggagttaccgaaagaaatgt |
2808816 |
T |
 |
| Q |
148 |
aattggatccatcaatattaattttgaaataacttaggaggtttccacttgatgagaatttcaatttgagtgtcactcaagt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2808817 |
aattggatccatcaatattaattttgaaataacttaggaggtttccacttgatgagaatttcaatttgagtgtcactcaagt |
2808898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University