View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5650_high_11 (Length: 244)

Name: NF5650_high_11
Description: NF5650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5650_high_11
NF5650_high_11
[»] chr2 (1 HSPs)
chr2 (49-229)||(2808717-2808898)


Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 49 - 229
Target Start/End: Original strand, 2808717 - 2808898
Alignment:
49 ttagggccggcttattggagagggagaaaacacatatgtaataaacatactattgagtcgcgaaaaaggtcac-acaatacgagttaccgaaataaatgt 147  Q
    ||||||||| |||  ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||||||||| ||||||    
2808717 ttagggccgacttgatggagagggagaaaacacatatgtaataaacatactattaagtcgcgaaaaaggtcaccacaataggagttaccgaaagaaatgt 2808816  T
148 aattggatccatcaatattaattttgaaataacttaggaggtttccacttgatgagaatttcaatttgagtgtcactcaagt 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2808817 aattggatccatcaatattaattttgaaataacttaggaggtttccacttgatgagaatttcaatttgagtgtcactcaagt 2808898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University