View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5652-Insertion-1 (Length: 117)
Name: NF5652-Insertion-1
Description: NF5652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5652-Insertion-1 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 8 - 117
Target Start/End: Original strand, 45364059 - 45364168
Alignment:
| Q |
8 |
attggttggtaaaatcaaggaaagcacaagtctatccacttgtgtattgtgattttaactcttactcttacacttagtgttctttttcagctataaatag |
107 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45364059 |
attggttggtaaaatctagaaaagcacaagtctatccacttgtgaattgtgattttaactcttactcttacacttggtgttctttttcagctataaatag |
45364158 |
T |
 |
| Q |
108 |
actacacttc |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
45364159 |
actacacttc |
45364168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University