View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5652-Insertion-8 (Length: 340)
Name: NF5652-Insertion-8
Description: NF5652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5652-Insertion-8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 6 - 340
Target Start/End: Complemental strand, 1111927 - 1111593
Alignment:
| Q |
6 |
cataaccaggaggaccaatgtgtgaggccatttcctttctcatctgcacaatttatttaaataaataaataaacatttttgaacacaacccattgatggg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1111927 |
cataaccaggaggaccaatgtgtgaggccatttcctttctcatctgcacaatttatttaaataaataaataaacatttttgaacacaacccattgatggg |
1111828 |
T |
|
| Q |
106 |
gtttgaaaattgaagttaaaaattgaaactttagttaggttgagaaagataacatacgagggcgggtttaggttgataaatagcgacttcatcttgaggg |
205 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1111827 |
gtttgaaaattgaagttaaaaaatgaaactttagttaggttgagaaagataacatacgagggcgggtttaggttgataaatagcgacttcatcttgaggg |
1111728 |
T |
|
| Q |
206 |
gtataaccagctctgatgcgaactggttttcggagtgtaccatcgggtcgacgggtcggggcgaggatccgttcaccatcttttggttgcttctgcttca |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1111727 |
gtataaccagctctgatgcgaactggttttcggagtgtaccatcgggtcgacgggtcggggcgaggatccgttcaccatcttttggttgcttctgcttca |
1111628 |
T |
|
| Q |
306 |
cttgttgttgatcttcactcgtcgacatcactctt |
340 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1111627 |
cttgtcgttgatcttcactcgtcgacatcactctt |
1111593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University