View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5652_high_7 (Length: 269)
Name: NF5652_high_7
Description: NF5652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5652_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 53180107 - 53179844
Alignment:
| Q |
1 |
tagtaacaagaagttatgtgaagctcgtgaagagaaagcaaattaaattaatatagcaatatctctagttatgatcatggcttgcatatccaatttgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53180107 |
tagtaacaagaagttatgtgaagctcgtgaagagaaagcaaattaaattaatatagcaatatctctagttatgatcatggcttgcatatccaatttgaac |
53180008 |
T |
 |
| Q |
101 |
tttcattggagactgttgttgtggtcttagctgggcaactttaatggctaaaggtgaccacacgcgcatgtttgaataagtagttggctagaaagggact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53180007 |
tttcattggagactgttgttgtggtcttagctgggcaactttaatgcctaaaggtgaccacacacgcatgtttgaataagtagttggctagaaagggact |
53179908 |
T |
 |
| Q |
201 |
ttgtctcttccaagttcccagattatggtggaacaagaactaagtaacatgcccctttgcttct |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
53179907 |
ttgtctcttccaagttcccagattatggtggaacaagaactaagtaacatgccccattgattct |
53179844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University