View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5652_low_10 (Length: 240)

Name: NF5652_low_10
Description: NF5652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5652_low_10
NF5652_low_10
[»] chr7 (2 HSPs)
chr7 (93-225)||(44654043-44654172)
chr7 (1-31)||(44654234-44654264)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 93 - 225
Target Start/End: Complemental strand, 44654172 - 44654043
Alignment:
93 gtgatattgattttagattcggaggttcaccagattaaaagtttagtctagtgttaaaatatatattttagattctaagatcctagattcaagctcttta 192  Q
    ||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||||||||    
44654172 gtgatattgattttagattcggaggttcac---attaaaagtttagtctagtgttaaaatatagattttagattataagatgctagattcaagctcttta 44654076  T
193 gcattcttaaaaagagataaatgtacatatttt 225  Q
    |||||||||||||||||||||||||||||||||    
44654075 gcattcttaaaaagagataaatgtacatatttt 44654043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 44654264 - 44654234
Alignment:
1 tatatcaatagctaatgatcgacaatgtctc 31  Q
    |||||||||||||||||||||||||||||||    
44654264 tatatcaatagctaatgatcgacaatgtctc 44654234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University