View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5652_low_10 (Length: 240)
Name: NF5652_low_10
Description: NF5652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5652_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 93 - 225
Target Start/End: Complemental strand, 44654172 - 44654043
Alignment:
| Q |
93 |
gtgatattgattttagattcggaggttcaccagattaaaagtttagtctagtgttaaaatatatattttagattctaagatcctagattcaagctcttta |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||||||| |
|
|
| T |
44654172 |
gtgatattgattttagattcggaggttcac---attaaaagtttagtctagtgttaaaatatagattttagattataagatgctagattcaagctcttta |
44654076 |
T |
|
| Q |
193 |
gcattcttaaaaagagataaatgtacatatttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44654075 |
gcattcttaaaaagagataaatgtacatatttt |
44654043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 44654264 - 44654234
Alignment:
| Q |
1 |
tatatcaatagctaatgatcgacaatgtctc |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44654264 |
tatatcaatagctaatgatcgacaatgtctc |
44654234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University