View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5652_low_6 (Length: 285)
Name: NF5652_low_6
Description: NF5652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5652_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 12 - 273
Target Start/End: Original strand, 44654272 - 44654533
Alignment:
| Q |
12 |
gtttgtgattcgattttagttcgtcaggttaaattgtttgggatcaatcgttttcactagatgtaactaatctctttttatataaaaatatgacattgct |
111 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44654272 |
gtttgtgattcgattttagtttgtcaggttaaattgtttgggatcaatcgttttcactagatgtaactaatctctttttatataaaaacatgacattgct |
44654371 |
T |
 |
| Q |
112 |
ttaaactcctagagtttgttctagtaataaaaatatatgttttggactcggaggtttttggttcaagatctattaatacttttaaaatgagatagatgta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44654372 |
ttaaactcctagagtttgttctagtaataaaaatatatgttttggactcggagatttttggttcaagatctattaatacttttaaaacgagatagatgta |
44654471 |
T |
 |
| Q |
212 |
tatatttactattattcgagctctaatgtcttctgcttttgactaagcatcccctcaaccta |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44654472 |
tatatttactattattcgagctctaatgtcttctgcttttgactaagcatcccctcaaccta |
44654533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University