View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5653-Insertion-1 (Length: 150)
Name: NF5653-Insertion-1
Description: NF5653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5653-Insertion-1 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 2e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 14 - 150
Target Start/End: Complemental strand, 8830992 - 8830856
Alignment:
| Q |
14 |
tactgcctaatgtaagtaatatgcgtcttaacaaaaacaaaatcctcacacttcacaggcttctcctcctccttcttcgaaccacaatcatgtcatccca |
113 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8830992 |
tactgcctaatgtaagtaatatgtgtcttaacaaaaacaaaaacctcacacttcgcaggcttctcctcctccttcttcgaaccacaatcatgtcatccca |
8830893 |
T |
|
| Q |
114 |
caccttctccttcactttgtctatgccgtccactcct |
150 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8830892 |
caccttctccttcactgtgtctatgccgtccactcct |
8830856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.0000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 78 - 126
Target Start/End: Complemental strand, 43985092 - 43985044
Alignment:
| Q |
78 |
cctcctccttcttcgaaccacaatcatgtcatcccacaccttctccttc |
126 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
43985092 |
cctcctccttcttcgacccatgatcatgtcatcccacgccttctccttc |
43985044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University