View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5653-Insertion-5 (Length: 263)
Name: NF5653-Insertion-5
Description: NF5653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5653-Insertion-5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 6 - 263
Target Start/End: Original strand, 7735722 - 7735979
Alignment:
| Q |
6 |
caataagggggtccctttctttaatgggcatatatcatttttcatcaaactagtaacaattaacatgagtgacatggtagctatccatagagtgagtagg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7735722 |
caataagggggtccctttctttaatgggcatatatcatttttcatcaaactagtaacaattaacatgagtgacatggtagctatccatagagtgagtagg |
7735821 |
T |
|
| Q |
106 |
catatttatgtattggtaactgccaaactacaatgacctacttgtcacattgttgtatgtcatgttttctcaatgatatatgaaacatcataattgattt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7735822 |
catatttatgtattggtaactgccaaactacaatgacctacttgtcacattgttgtatgtcatgttttctcaatgatatatgaaacatcataattgattt |
7735921 |
T |
|
| Q |
206 |
ctcacaataatacagccttaattgcttatggacttgaacaacctcattgctttgcttg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7735922 |
ctcacaataatacagccttaattgcttatggacttgaacaacctcattgctttgcttg |
7735979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University