View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5653_low_3 (Length: 269)
Name: NF5653_low_3
Description: NF5653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5653_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 21 - 247
Target Start/End: Original strand, 3018290 - 3018516
Alignment:
| Q |
21 |
atgggaaactagaatgcagcatatgctcaataacttttacaatttcagtgttaccaaaagaactaaaatgagtgtttgctctttaaaattgtgtcgcatt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3018290 |
atgggaaactagaatgcagcatatgctcaataacttttacaatttcagtgtcaccaaaagaactaaaatgagtgtttgctctttaaaattgtgtcgcatt |
3018389 |
T |
 |
| Q |
121 |
ggaacatcctaaagcctaagctgtagagctagtgannnnnnnnngtgaaacatagtaatctaataatatcaagccaatcattgtataactaatgatttag |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3018390 |
ggaacatcctaaagcctaagctgtagagctagtgatttttttttgtgaaacatagtaatctaataatatcaagccaatcattgtataactaatgatttag |
3018489 |
T |
 |
| Q |
221 |
aggctttggtaatttccacactaaatt |
247 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3018490 |
aggctttggtaatttccacactaaatt |
3018516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University