View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654-Insertion-1 (Length: 122)
Name: NF5654-Insertion-1
Description: NF5654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654-Insertion-1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 7 - 116
Target Start/End: Complemental strand, 32036594 - 32036485
Alignment:
| Q |
7 |
atgaaaggcataaagggttatgagccacgttcaagctcatcttgtgcagcttgcaaatgattgaaaagaagatgcacaccagattgcttatttgcacctt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32036594 |
atgaaaggcataaagggttatgagccacgttcaagctcatcttgtgcagcttgcaaattattgaaaagaagatgcacaccagattgcttatttgcacctt |
32036495 |
T |
|
| Q |
107 |
acttccattc |
116 |
Q |
| |
|
|||||||||| |
|
|
| T |
32036494 |
acttccattc |
32036485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 110
Target Start/End: Complemental strand, 35808949 - 35808858
Alignment:
| Q |
19 |
aagggttatgagccacgttcaagctcatcttgtgcagcttgcaaatgattgaaaagaagatgcacaccagattgcttatttgcaccttactt |
110 |
Q |
| |
|
||||||||||| ||| | ||||| || ||||||||||| ||||||| ||||||||||||||| |||| |||| ||||||| || ||||| |
|
|
| T |
35808949 |
aagggttatgaaccaaggtcaagttcctcttgtgcagcctgcaaatttctgaaaagaagatgcataccaaattgtatatttgcgccatactt |
35808858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University