View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_1D_high_25 (Length: 259)
Name: NF5654_1D_high_25
Description: NF5654_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_1D_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 21 - 238
Target Start/End: Complemental strand, 43531772 - 43531564
Alignment:
| Q |
21 |
tggtgttagagcttatccatttagtgccaccgactacttacaagttggtttgtattaattgttggttagttaaagtttcttactatcctatagttacacg |
120 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43531772 |
tggtattagagcttatccatttagcgccaccgacta---------tggtttgtattaattgtaggttagttaaagtttgttactatcctatagttacacg |
43531682 |
T |
 |
| Q |
121 |
atcattcttacaatttatttgtttctttattgcactctaccatatttctcagtatctagtggaggcatatgagactcgagtagcagaaacagagaagaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43531681 |
atcattcttacaatttatttgtttctttattgcactctaccatatttctcagtatctagtggaggcatatgagactcgagtagcagaaacagagaagaaa |
43531582 |
T |
 |
| Q |
221 |
aagctaatggttccaatt |
238 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43531581 |
aagctaatggttccaatt |
43531564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 170 - 232
Target Start/End: Original strand, 24128063 - 24128125
Alignment:
| Q |
170 |
cagtatctagtggaggcatatgagactcgagtagcagaaacagagaagaaaaagctaatggtt |
232 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || |||||||||||||||||| |||||||| |
|
|
| T |
24128063 |
cagtatctagtggaggcatatgaatctcgagttgcggaaacagagaagaaaaagataatggtt |
24128125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 222
Target Start/End: Original strand, 24145825 - 24145877
Alignment:
| Q |
170 |
cagtatctagtggaggcatatgagactcgagtagcagaaacagagaagaaaaa |
222 |
Q |
| |
|
|||||||| |||||||||| ||| ||||| | |||||||||||||||||||| |
|
|
| T |
24145825 |
cagtatctggtggaggcatttgaatctcgacttgcagaaacagagaagaaaaa |
24145877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University