View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_1D_high_27 (Length: 254)
Name: NF5654_1D_high_27
Description: NF5654_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_1D_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 17261556 - 17261323
Alignment:
| Q |
12 |
gatggacatcacaacgacgcactgagacgacgatgttgttagcctgtattttcagccggtaataaatgcggtcgatatggtgtagcaatatcttttattg |
111 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||| || ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17261556 |
gatgaacatcacaacgacgcaccgagacgacgatgttgt-aggctgtattttcaacaggtaataaatgcggtcgatatggtgtagcaatatcttttattg |
17261458 |
T |
 |
| Q |
112 |
tttgaattggtatgggttataataaccacatctttcacgatcttatatgtgccaaatatctaagagctagcaatagtaacattaattgtaatataaagcc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17261457 |
tttgaattggtatgggttataataaccacatctttcacgatcttatatgtgccaaatatctaagagctagcaatagtaac----attgtaatataaagcc |
17261362 |
T |
 |
| Q |
212 |
tattatgcaaactaagatgcataatgtccaaaacattga |
250 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17261361 |
tatgatgcaaactaagatgcataatgtccaaaacattga |
17261323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University