View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_1D_high_33 (Length: 224)
Name: NF5654_1D_high_33
Description: NF5654_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_1D_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 7 - 213
Target Start/End: Original strand, 33110687 - 33110889
Alignment:
| Q |
7 |
tatagccattagaaaattgagaaagagcctatatataggattggattgattgctagttgcgccactctcatcacactttgctatgcttccctgattctct |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33110687 |
tatatccattagaaaattgagaaagagcctata----ggattggattgattgctagttgcgccactctcatcacactttgctatgcttccctgattctct |
33110782 |
T |
 |
| Q |
107 |
cataaatcaccaacttcaacaattttagcaaaattaattaaacaagatggaaggtggagtaccagaggctgatatctcagcttttagagaatgtatgtct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33110783 |
cataaatcaccaacttcaacaattttagcaaaattaattaaacaagatggaaggtggagtaccagaggctgatatctcagcttttagagaatgtatgtct |
33110882 |
T |
 |
| Q |
207 |
ctttcat |
213 |
Q |
| |
|
||||||| |
|
|
| T |
33110883 |
ctttcat |
33110889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University