View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5654_1D_high_35 (Length: 220)

Name: NF5654_1D_high_35
Description: NF5654_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5654_1D_high_35
NF5654_1D_high_35
[»] chr3 (1 HSPs)
chr3 (11-193)||(32261317-32261499)


Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 11 - 193
Target Start/End: Complemental strand, 32261499 - 32261317
Alignment:
11 atgaatcacaaagacacataagggactttcttgaattgggttgcaaatttccactagggcagtcatgccacgaacgtttccttcactatgtaaacaagta 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32261499 atgaatcacaaagacacataagggactttcttgaattgggttgcaaatttccactagggcagtcatgccacgaacgtttccttcactatgtaaacaagta 32261400  T
111 acaatgcgaaactctgaatttcttggagtgttttggattgttctcatttcttcatcaaatatgcttgatgaacttaagactcg 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
32261399 acaatgcgaaactctgaatttcttggagtgttttggattgttctcatttcttcatcaaatatgcttgatgaacttaatactcg 32261317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University