View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_1D_low_40 (Length: 250)
Name: NF5654_1D_low_40
Description: NF5654_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_1D_low_40 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 9067775 - 9067527
Alignment:
| Q |
1 |
aatggatatgactcttctaaatgtgtgtggttgatattatgcatgtattgtatatataataatatccacttatttgctgatcaatcaatccttcaacaaa |
100 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9067775 |
aatggatatgactcttctaaacgtgtgttgttgatattatgcatgtattgtatatataataatatccacttatttgttgatcaatcaatccttcaacaaa |
9067676 |
T |
 |
| Q |
101 |
aaacacttatttggtaatcgatggttgatattatcctaattaaaatgataatatcttgttgaaccatctgatcatgatctaacggtcaataacgattgac |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9067675 |
aaa-acttatttggtaatcgatggttgatattatcctaattaaaatgataatatcttgttcaaccatctgatcatgatcgaacggtcaataacgattgac |
9067577 |
T |
 |
| Q |
201 |
tttgtgaatgctgaaaaattgttactacatataatccaactccgcatatt |
250 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
9067576 |
tttgtaaatgctgaaaaattgctactacatataatccaactccgaatatt |
9067527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University