View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_1D_low_43 (Length: 249)
Name: NF5654_1D_low_43
Description: NF5654_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_1D_low_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 12 - 235
Target Start/End: Original strand, 32259719 - 32259942
Alignment:
| Q |
12 |
ggtggtgaggagagaattcttgtttccgttcgtgtgcggccgctgaatgaaaaggagttatggaaaaatgatctgtctgaatgggaatgcattaatgaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259719 |
ggtggtgaggagagaattcttgtttccgttcgtgtgcggccgctgaatgaaaaggagttatggaaaaatgatctgtctgaatgggaatgcattaatgaca |
32259818 |
T |
 |
| Q |
112 |
ctaccattatgtacaggagcaacctttcagcttctgaaaggtctttgtatccaacaacctattcatttggtatgaagaggcttatgttacaaatccatcc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259819 |
ctaccattatgtacaggagcaacctttcagcttctgaaaggtctttgtatccaacaacctattcatttggtatgaagaggcttatgttacaaatccatcc |
32259918 |
T |
 |
| Q |
212 |
atagatttatttacttggtgtttg |
235 |
Q |
| |
|
|| ||||||||||||||||||||| |
|
|
| T |
32259919 |
attgatttatttacttggtgtttg |
32259942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 77 - 185
Target Start/End: Original strand, 8393344 - 8393452
Alignment:
| Q |
77 |
aaatgatctgtctgaatgggaatgcattaatgacactaccattatgtacaggagcaacctttcagcttctgaaaggtctttgtatccaacaacctattca |
176 |
Q |
| |
|
||||||| | ||||| |||||||| || ||||| ||||||||||| ||||||| ||| |||||||||||||||| ||| | ||||||||| | |||||| |
|
|
| T |
8393344 |
aaatgatgtatctgattgggaatgtatcaatgatactaccattatatacaggaataacatttcagcttctgaaagatctctctatccaacagcatattca |
8393443 |
T |
 |
| Q |
177 |
tttggtatg |
185 |
Q |
| |
|
||||||||| |
|
|
| T |
8393444 |
tttggtatg |
8393452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University