View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_1D_low_44 (Length: 246)
Name: NF5654_1D_low_44
Description: NF5654_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_1D_low_44 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 23 - 246
Target Start/End: Complemental strand, 56492588 - 56492365
Alignment:
| Q |
23 |
acttatagcctttgacatcaaaagaatgagcagcacctccagcatggtcgtggctttcgaaaacgacaacatcttgttcatatcttgccaacagtgctgc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492588 |
acttatagcctttgacatcaaaagaatgagcagcacctccagcatggtcgtggctttcgaaaacgacaacatcttgttcatatcttgccaacagtgctgc |
56492489 |
T |
 |
| Q |
123 |
acaactcagtccaccaataccactcccaatcacaattacatctgtttctgtttcatctactttgttgctgctgtttcgcgccacaaccccacctttccta |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
56492488 |
acaactcagtccaccaataccactcccaatcacaattacatctgtttctgtttcatctactttgttgctgctgtttcgcaccacaaccccacctttccta |
56492389 |
T |
 |
| Q |
223 |
atcctcccattactatgactatga |
246 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
56492388 |
atcctcccattactatgactatga |
56492365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University