View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_1D_low_50 (Length: 240)
Name: NF5654_1D_low_50
Description: NF5654_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_1D_low_50 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 12 - 240
Target Start/End: Complemental strand, 5146453 - 5146225
Alignment:
| Q |
12 |
atgaaagagacattatactttaacctaaaattttaaaattttaagtatatgagtcatcttctttataaagtattcaacgtccacatttttaaacattatg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5146453 |
atgaaagagacattatactttaacctaaaattttaaaattttaggtgtatgagtcatcttctttataaagtattcaacgtccacatttttaaacattatg |
5146354 |
T |
|
| Q |
112 |
aaacttctaaatcatacttattatacacaacaaatgagagaagtctattgtagatgctcactagtaaattgatccaattcaaaataattaaattaagtta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5146353 |
aaacttctaaatcatacttattatacacaacaaatgagagaagtctattgtagatgctcacaagtaaattgatccaattcaaaataattaaattaagtta |
5146254 |
T |
|
| Q |
212 |
ttcattcctttatattttggtcaataatt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5146253 |
ctcattcctttatattttggtcaataatt |
5146225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 5146182 - 5146136
Alignment:
| Q |
157 |
tattgtagatgctcactagtaaattgatccaattcaaaataattaaa |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5146182 |
tattgtagatgctcacaagtaaattgatccaattcaaaataattaaa |
5146136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University