View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_1D_low_59 (Length: 225)
Name: NF5654_1D_low_59
Description: NF5654_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_1D_low_59 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 16 - 136
Target Start/End: Complemental strand, 10523584 - 10523463
Alignment:
| Q |
16 |
acatcatacaatggcaaacgacaacaacccgataaatataacttccc-tcggtaaatctaagtggtgacaaaaacatgtattttcggaataaacaatgct |
114 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
10523584 |
acatcagacaatggtaaacgacaacaacccgataaatataacttccagtcggtaaatctaagtggtgacaaaaacaagcattttcggaataaacaatgca |
10523485 |
T |
|
| Q |
115 |
tgcacaatatttgtgattgtat |
136 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
10523484 |
tgcacaatatttgtgattgtat |
10523463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 131 - 225
Target Start/End: Original strand, 10523354 - 10523448
Alignment:
| Q |
131 |
ttgtatgataaaattgtttatttttatgttatctatcctggctttttatctttcatacatatgggatgtttaaagtaactgataactggatttgg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10523354 |
ttgtatgataaaattgtttatttttatgttatctatcttggctttttatctttcatacttatgggatgtttaaagtaactgataactggatttgg |
10523448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University