View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_1D_low_63 (Length: 222)
Name: NF5654_1D_low_63
Description: NF5654_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_1D_low_63 |
 | |
|
| [»] scaffold0237 (2 HSPs) |
| |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold0237 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: scaffold0237
Description:
Target: scaffold0237; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 91 - 222
Target Start/End: Original strand, 26714 - 26845
Alignment:
| Q |
91 |
taaactcaaaagccctacctgtgaattttctatgcagaaaataccataacttttgacttgactagtcaacaaccaaggctaaggacaaggtttgttagtt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26714 |
taaactcaaaagccctacctgtgaattttctatgcagaaaataccataacttttgacttgactagtcaacaaccaaggctaaggacaaggtttgttagtt |
26813 |
T |
|
| Q |
191 |
aaataattaaaggtccgtttggatcgtcttat |
222 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| |
|
|
| T |
26814 |
aaataattaacggtcagtttggatcgtcttat |
26845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0237; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 55
Target Start/End: Original strand, 26639 - 26679
Alignment:
| Q |
15 |
ggacatcacttgtcttatctcatgctgttcttgtgatattg |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26639 |
ggacatcacttgtcttatctcatgctgttcttgtgatattg |
26679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 91 - 222
Target Start/End: Original strand, 29836889 - 29837020
Alignment:
| Q |
91 |
taaactcaaaagccctacctgtgaattttctatgcagaaaataccataacttttgacttgactagtcaacaaccaaggctaaggacaaggtttgttagtt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29836889 |
taaactcaaaagccctacctgtgaattttctatgcagaaaataccataacttttgacttgactagtcaacaaccaaggctaaggacaaggtttgttagtt |
29836988 |
T |
|
| Q |
191 |
aaataattaaaggtccgtttggatcgtcttat |
222 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| |
|
|
| T |
29836989 |
aaataattaacggtcagtttggatcgtcttat |
29837020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 55
Target Start/End: Original strand, 29836813 - 29836853
Alignment:
| Q |
15 |
ggacatcacttgtcttatctcatgctgttcttgtgatattg |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29836813 |
ggacatcacttgtcttatctcatgctgttcttgtgatattg |
29836853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University