View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_1D_low_70 (Length: 210)
Name: NF5654_1D_low_70
Description: NF5654_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_1D_low_70 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 21 - 113
Target Start/End: Complemental strand, 13653014 - 13652922
Alignment:
| Q |
21 |
acaactgacttcaacggttgagattcgagccatgtcatgcaggttctatccactttgaagaaattggagttgaaagatgatgatgttgttttt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13653014 |
acaactgacttcaacggttgagattcgagccatgtcatgcaggttctatccactttgaagaaattggagttgaaagatgatgatgttgttttt |
13652922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 21 - 86
Target Start/End: Complemental strand, 13658487 - 13658422
Alignment:
| Q |
21 |
acaactgacttcaacggttgagattcgagccatgtcatgcaggttctatccactttgaagaaattg |
86 |
Q |
| |
|
||||| || ||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
13658487 |
acaaccgatttcaacggttgagattcaagccatgtcatgcaagttctatccacttcgaagaaattg |
13658422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 23 - 86
Target Start/End: Complemental strand, 13647957 - 13647894
Alignment:
| Q |
23 |
aactgacttcaacggttgagattcgagccatgtcatgcaggttctatccactttgaagaaattg |
86 |
Q |
| |
|
|||||| ||||| |||||||| || ||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
13647957 |
aactgatttcaatggttgagagtcaagccacgccatgcaggttctatccactttgaagaaattg |
13647894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 107 - 209
Target Start/End: Original strand, 32365736 - 32365837
Alignment:
| Q |
107 |
tgtttttgttacgacattaggtggtggcatcatatatggctttgcggtggtttggttgcttaaacctgaaggtctggttattttaacctgaaatggtcgt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
32365736 |
tgtttttgttacgacattaggtggtggcatcatatatggctttgcggtggtttggttgcttaaacctgaaggtct-gttattttaacctgaaatggttgt |
32365834 |
T |
|
| Q |
207 |
ttg |
209 |
Q |
| |
|
||| |
|
|
| T |
32365835 |
ttg |
32365837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University