View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_high_38 (Length: 366)
Name: NF5654_2D_high_38
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 104 - 321
Target Start/End: Original strand, 56070036 - 56070256
Alignment:
| Q |
104 |
atcgtccaaaaacaccactttcttgagctttggaaatatctcaggcaagtagaagcggaggtggttcatcatattctgttgtaaggcgcaatggaagaca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56070036 |
atcgtccaaaaacaccactttcttgagctttggaaatatctcaggcaagtagaagcggaggtggttcatcatattctgttgtaaggcgcaatggaagaca |
56070135 |
T |
 |
| Q |
204 |
gtggatagctttgggcagccaactgtgttaaggccaatcaaggcttttttcttgtgcacatgaagctgatgctctgatgagtggagcctagctctaagct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56070136 |
gtggatagctttgggcagccaactgtgttaaggccaattaaggcttttttcttgtgcacacgaagctgatgctctgatgagtggagcctagctctaagct |
56070235 |
T |
 |
| Q |
304 |
tc---ttcacagctgtggcac |
321 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
56070236 |
tctaattcacagctgtggcac |
56070256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 56069889 - 56070001
Alignment:
| Q |
1 |
attctttgcaacaagaggatttgagaagttgaggtaaccatcaaaacgatggaaacttcctgcacaagtttcaacagcaccgtttatgtttccctccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56069889 |
attctttgcaacaagaggatttgagaagttgaggtaaccatcaaaacgatggaaacttcctgcacaagtttcaacagcaccgtttatgtttccctccaaa |
56069988 |
T |
 |
| Q |
101 |
ttaatcgtccaaa |
113 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
56069989 |
ttaatcgaccaaa |
56070001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 316 - 351
Target Start/End: Complemental strand, 56069568 - 56069533
Alignment:
| Q |
316 |
tggcacgtcttgggtcttggctacaaccctgatgtc |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
56069568 |
tggcacgtcttgggtcttggctacaaccctgatgtc |
56069533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 38398433 - 38398329
Alignment:
| Q |
1 |
attctttgcaacaagaggatttgagaagttgaggtaaccatcaaaacgatggaaacttcctgcacaagtttcaacagcaccgtttatgtttccctccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||| |||||||| || || ||||||||| |||||||| |||||||| |||| |||| |
|
|
| T |
38398433 |
attctttgcaacaagaggatttgagaagttaaggtaactatcaaatcgatggaatttttttgtacaagtttcgacagcaccatttatgttacccttcaaa |
38398334 |
T |
 |
| Q |
101 |
ttaat |
105 |
Q |
| |
|
|||| |
|
|
| T |
38398333 |
gtaat |
38398329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 108 - 171
Target Start/End: Complemental strand, 38398285 - 38398222
Alignment:
| Q |
108 |
tccaaaaacaccactttcttgagctttggaaatatctcaggcaagtagaagcggaggtggttca |
171 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||| |||||||||||||||||||| |||| |
|
|
| T |
38398285 |
tccaaaaacagaactttcttgagctttgggaatatctctggcaagtagaagcggaggtgattca |
38398222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 265 - 321
Target Start/End: Complemental strand, 38397524 - 38397468
Alignment:
| Q |
265 |
gaagctgatgctctgatgagtggagcctagctctaagcttcttcacagctgtggcac |
321 |
Q |
| |
|
|||||| || ||||||| |||||| | |||| |||||||||||| |||||||||||| |
|
|
| T |
38397524 |
gaagcttatcctctgataagtggatcatagccctaagcttcttcgcagctgtggcac |
38397468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 10170557 - 10170480
Alignment:
| Q |
1 |
attctttgcaacaagaggatttgagaagttgaggtaaccatcaaaacgatggaaacttcctgcacaagtttcaacagc |
78 |
Q |
| |
|
||||||||||| |||||||||||||||||| || |||| |||||| |||||||||||| || |||||||||| ||||| |
|
|
| T |
10170557 |
attctttgcaataagaggatttgagaagttcagataacgatcaaatcgatggaaactttctccacaagtttctacagc |
10170480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University