View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_high_48 (Length: 271)
Name: NF5654_2D_high_48
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_high_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 8248924 - 8248672
Alignment:
| Q |
1 |
tgattttatagaagattttgatgatgatgatgagaagctcattaatcttaaacaacagtaacgagagagggtgagttattggaggtgttagtggaaggcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||| |||||||||||||||||| |||||||| |
|
|
| T |
8248924 |
tgattttatagaagattttgatgatgatga---gaagctcattaatcttaaacaacagtaacgagcgaaggtaagttattggaggtgttagcggaaggcg |
8248828 |
T |
 |
| Q |
101 |
agttattggaggtgttagcagcatataaagtttatgcgattcagaagaaagcatggttctcttttactatggagaataggtcaatttcaaagaaacttgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
8248827 |
agttattggaggtgttagcagcatataaagtttatgcgattcagaagaaagcagggttctcttttactatggagaataggtcagtttcaaataaacttgt |
8248728 |
T |
 |
| Q |
201 |
ggttttggaacatgtggatgtgaagaataaagtaacaagggagagagttaatgatg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8248727 |
ggttttggaacatgtggatgtgaagaatagagtaacaagggagagagttaatgatg |
8248672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University