View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_high_52 (Length: 259)
Name: NF5654_2D_high_52
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_high_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 237
Target Start/End: Complemental strand, 31194203 - 31193976
Alignment:
| Q |
10 |
atggtgttactgctgttggttatggtagtgctaatgggactgattattggattgtgaagaattcatggggcactgtgtggggtgaaaaagggtacataag |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31194203 |
atggtgttactgctgttggttatggtagtgctaatgggactgattattggattgtgaagaattcatggggcactgtgtggggtgagaaagggtacataag |
31194104 |
T |
 |
| Q |
110 |
aatgcaaagaggtatagctgataaggaaggcttatgtggtattgcaatggattcttcttatccaactgcttaacctgttgaattatgtaacttgtgtctc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31194103 |
gatgcaaagaggtatagctgataaggaaggcttatgtggtattgcaatggattcttcttatccaactgcttaacctgttgaattatgtaacttgtgtctc |
31194004 |
T |
 |
| Q |
210 |
aagcttgtattttaacaacattaaatat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31194003 |
aagcttgtattttaacaacattaaatat |
31193976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 10 - 222
Target Start/End: Complemental strand, 31185376 - 31185164
Alignment:
| Q |
10 |
atggtgttactgctgttggttatggtagtgctaatgggactgattattggattgtgaagaattcatggggcactgtgtggggtgaaaaagggtacataag |
109 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31185376 |
atggtgtcactgctgttggatatggtagtgctaatggtactgattattggattgtgaagaattcatggggcactgtgtggggtgaaaaagggtacataag |
31185277 |
T |
 |
| Q |
110 |
aatgcaaagaggtatagctgataaggaaggcttatgtggtattgcaatggattcttcttatccaactgcttaacctgttgaattatgtaacttgtgtctc |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| | | | |||||||||||||||||| |
|
|
| T |
31185276 |
gatgcaaagaggtatagctgctaaggaaggcttatgtggtattgccatggattcttcttatccaactgcttaaattatccagttatgtaacttgtgtctc |
31185177 |
T |
 |
| Q |
210 |
aagcttgtatttt |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31185176 |
aagcttgtatttt |
31185164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 47 - 118
Target Start/End: Original strand, 31727565 - 31727636
Alignment:
| Q |
47 |
gactgattattggattgtgaagaattcatggggcactgtgtggggtgaaaaagggtacataagaatgcaaag |
118 |
Q |
| |
|
|||||| |||||| | ||||||||||||||||| ||| ||||||||| |||||||||| || |||||||| |
|
|
| T |
31727565 |
gactgagtattggttggtgaagaattcatggggaactcaatggggtgaagaagggtacattaggatgcaaag |
31727636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University