View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_high_57 (Length: 242)
Name: NF5654_2D_high_57
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_high_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 179
Target Start/End: Complemental strand, 40093152 - 40092986
Alignment:
| Q |
13 |
agatgaataatagtaacgtgacatttacaaggactattctgcacgatctttatgagaaacaaagacagagtccttactatgataatctatgtcgaccagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40093152 |
agatgaataatagtaacgtgacatttacaaggactattctgcacgatctttatgagaaacaaagacagagtccttactatgataatctatgtcgaccagt |
40093053 |
T |
 |
| Q |
113 |
ttcagatttggttccattcattgcttctggaatcagaggtgttactaccaatcctgcggtattcttc |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40093052 |
ttcagatttggttccattcattgcttctggaatcagaggtgttactaccaatcctgcggtattcttc |
40092986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 196 - 225
Target Start/End: Complemental strand, 40092982 - 40092953
Alignment:
| Q |
196 |
tttgaaaacaacatgattttgtcttttgtt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40092982 |
tttgaaaacaacatgattttgtcttttgtt |
40092953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University