View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_high_58 (Length: 241)
Name: NF5654_2D_high_58
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_high_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 12 - 112
Target Start/End: Complemental strand, 17748285 - 17748185
Alignment:
| Q |
12 |
gacatcatcacccaaatcttatgtatgctttgataattaaccaattattgacttatgtgctgctcaatgcctagaagaaaaccgtttgtagactttttta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17748285 |
gacatcatcacccaaatcttatgtatgctttgataattaaccaattattgacttatgtgctgctcaatgcctagaagaaaaccgtttgtagactttttta |
17748186 |
T |
|
| Q |
112 |
g |
112 |
Q |
| |
|
| |
|
|
| T |
17748185 |
g |
17748185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 12 - 112
Target Start/End: Complemental strand, 19049605 - 19049505
Alignment:
| Q |
12 |
gacatcatcacccaaatcttatgtatgctttgataattaaccaattattgacttatgtgctgctcaatgcctagaagaaaaccgtttgtagactttttta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19049605 |
gacatcatcacccaaatcttatgtatgctttgataattaaccaattattgacttatgtgctgctcaatgcctagaagaaaaccgtttgtagactttttta |
19049506 |
T |
|
| Q |
112 |
g |
112 |
Q |
| |
|
| |
|
|
| T |
19049505 |
g |
19049505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 154 - 241
Target Start/End: Complemental strand, 17748179 - 17748092
Alignment:
| Q |
154 |
ttcatgattctgtctgcaacactcaagatcatctcatgatttttaaaacatatctctttcttcttcccacatgaatcccaaacctctc |
241 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17748179 |
ttcatgattctgtctgcgacactcaagatcatctcatgatttttaaaacatatctctttcttcttcccacatgaatcccaaacctctc |
17748092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 154 - 241
Target Start/End: Complemental strand, 19049499 - 19049412
Alignment:
| Q |
154 |
ttcatgattctgtctgcaacactcaagatcatctcatgatttttaaaacatatctctttcttcttcccacatgaatcccaaacctctc |
241 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19049499 |
ttcatgattctgtctgcgacactcaagatcatctcatgatttttaaaacatatctctttcttcttcccacatgaatcccaaacctctc |
19049412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 17748030 - 17748085
Alignment:
| Q |
106 |
tttttaggagaaaa-aatgagacgaaagagagtggcaggttttggcgagttcatga |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17748030 |
tttttaggagaaaaaaatgagacgaaagagagtggcaggttttggcgagttcatga |
17748085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 19049350 - 19049405
Alignment:
| Q |
106 |
tttttaggagaaaa-aatgagacgaaagagagtggcaggttttggcgagttcatga |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19049350 |
tttttaggagaaaaaaatgagacgaaagagagtggcaggttttggcgagttcatga |
19049405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 199 - 234
Target Start/End: Original strand, 8037795 - 8037830
Alignment:
| Q |
199 |
aaacatatctctttcttcttcccacatgaatcccaa |
234 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8037795 |
aaacatatctctttcttcttccctcatgaatcccaa |
8037830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University