View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_high_66 (Length: 222)
Name: NF5654_2D_high_66
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_high_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 53041583 - 53041378
Alignment:
| Q |
1 |
cttaaaatatcaatctctatataaca--gtaataataaacaaaaatacaagtttcttgcaaatgtgaataccgacatgaggctagcattatatgaacgaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53041583 |
cttaaaatatcaatctctatataacacagtaataataaacaaaaaaacaagtttcttgcaaatgtgaataccgacatgaggctagcattatatgaacgaa |
53041484 |
T |
 |
| Q |
99 |
aagtcatcgggaacacgtgacttaccttcaagatcacatacgagtctccagtgaaaaactttccatgagaagactgagggatgggaactggattaaagtt |
198 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53041483 |
aagtcatcgagaacacgtgacttaccttcaagatcacatacgagtctccagtgaaaaactttccatgagaagactgagggatgggaactggattaaagtt |
53041384 |
T |
 |
| Q |
199 |
ctcaat |
204 |
Q |
| |
|
|||||| |
|
|
| T |
53041383 |
ctcaat |
53041378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University