View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_high_68 (Length: 218)
Name: NF5654_2D_high_68
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_high_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 93 - 202
Target Start/End: Original strand, 21683324 - 21683433
Alignment:
| Q |
93 |
ggagttggcattgcttctatcacagaccttcagctcaattttgttggaaccattctttcacttctagctatcataacaacatgtgttggccaaattgtat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21683324 |
ggagttggcattgcttctatcacagaccttcagctcaattttgttggaaccattctttcacttctagctatcataacaacatgtgttggccaaattgtat |
21683423 |
T |
 |
| Q |
193 |
cctttgatgt |
202 |
Q |
| |
|
||||| |||| |
|
|
| T |
21683424 |
cctttaatgt |
21683433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 21683297 - 21683202
Alignment:
| Q |
1 |
taatattccggctgcacatagtagtaaaataattcacaatcagattaagcaatttagcatgaccatggtcagatttaatttcaatatcactaggag |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21683297 |
taatattccggctgcacatagtagtaaattaattcacaatcagattaagcaatttagcatgaccatggtcagatttaatttcaatatcactaggag |
21683202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 93 - 197
Target Start/End: Complemental strand, 40412108 - 40412004
Alignment:
| Q |
93 |
ggagttggcattgcttctatcacagaccttcagctcaattttgttggaaccattctttcacttctagctatcataacaacatgtgttggccaaattgtat |
192 |
Q |
| |
|
|||||||| |||| |||||||| || ||||| ||||||||||| ||||||||| |||| |||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
40412108 |
ggagttggtgttgcctctatcactgatcttcaactcaattttgtgggaaccattatttcccttctagcaatcataacaacatgtgttagccaaattgtat |
40412009 |
T |
 |
| Q |
193 |
ccttt |
197 |
Q |
| |
|
||||| |
|
|
| T |
40412008 |
ccttt |
40412004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University