View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_high_70 (Length: 218)
Name: NF5654_2D_high_70
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_high_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 63 - 196
Target Start/End: Complemental strand, 40696450 - 40696317
Alignment:
| Q |
63 |
ctttaaccaacattgattcttggcatttggatggatatagtttctttgttgttggatatggagaaggagaatggaaagaagagtcaaggtcaagttataa |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40696450 |
ctttaaccaacattgattcttggcatttggatggatatagtttctttgttgttggatatggagaaggagaatggaaagaagagtcaaggtcaagttataa |
40696351 |
T |
 |
| Q |
163 |
cctatttgaccccgtcgttcgctcaactgtgcaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40696350 |
cctatttgaccccgtcgttcgctcaactgtgcaa |
40696317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 40696455 - 40696523
Alignment:
| Q |
1 |
cttaaccactatctctgcccactctttatgcaatgcacttgctacaaaaacatcgcgaaccgctttaac |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40696455 |
cttaaccactatctctgcccactctttatgcaatgcacttgctacaaaaacatcgcgaaccgctttaac |
40696523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University