View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5654_2D_high_74 (Length: 204)

Name: NF5654_2D_high_74
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5654_2D_high_74
NF5654_2D_high_74
[»] chr4 (1 HSPs)
chr4 (1-182)||(53744420-53744601)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 53744420 - 53744601
Alignment:
1 ctagatccaagaacaacaactacaatttcacgatcaactctgttgagtaacagaaattgaaattacagagcaagagcgaggagtacctgttcttcactca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||    
53744420 ctagatccaagaacaacaactacaatttcacgatcaactctgttgactgacagaaattgaaattacagagcaagagcgaggagtacctgttcttcactca 53744519  T
101 tgagttgctggagtctttctttaagagcaggaccatgccggccgccgctacgagcattgatgaaaacaaccataggagaagt 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53744520 tgagttgctggagtctttctttaagagcaggaccatgccggccgccgctacgagcattgatgaaaacaaccataggagaagt 53744601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University