View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_low_107 (Length: 264)
Name: NF5654_2D_low_107
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_low_107 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 20 - 264
Target Start/End: Original strand, 38265517 - 38265761
Alignment:
| Q |
20 |
ggaattctctccggcattgccaccatttggaaagaggaaggttcttatgctctttggagaggttggtctggcaaattatgtggatatggtattcaaggag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38265517 |
ggaattctctccggcattgccaccatttggaaagaggaaggttcttatgctctttggagaggttggtctggcaaattatgtggatatggtattcaaggag |
38265616 |
T |
 |
| Q |
120 |
ggttcaaatacggtctttatgagtatttcaaaaacttctatgccgccgacgatgatcgtgcattgattaagcttaatagaaattctatattctttctcag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38265617 |
ggttcaaatacggtctttatgagtatttcaaaaacttctatgccgccgacgatgatcgtgcattgattaagcttaatagaaattctatattctttctcag |
38265716 |
T |
 |
| Q |
220 |
tggtttgtctgcacagcttttagctgatgttactttagctccttt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38265717 |
tggtttgtctgcacagcttttagctgatgttactttagctccttt |
38265761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University