View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_low_112 (Length: 257)
Name: NF5654_2D_low_112
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_low_112 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 21683297 - 21683082
Alignment:
| Q |
1 |
taatattccggctgcacatagtagtaaaataattcacaatcagattaagcaatttagcatgaccatggtcagatttaatttcaatatcactaggaggggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21683297 |
taatattccggctgcacatagtagtaaattaattcacaatcagattaagcaatttagcatgaccatggtcagatttaatttcaatatcactaggaggggt |
21683198 |
T |
|
| Q |
101 |
ctcatgactaatttgttacctgaactgcttctttaggaaaagggtttctagcataactgtgaatggtatgattgcaagttttgtcatctacaaaattaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21683197 |
ctcatgactaatttgttacctgaactgcttctttaggaaaagggtttctagcataactgtgaatggtatgattgcaagttttgtcatctacaaaattaac |
21683098 |
T |
|
| Q |
201 |
attaaaatcaatatat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
21683097 |
attaaaatcaatatat |
21683082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 116 - 195
Target Start/End: Original strand, 40412240 - 40412319
Alignment:
| Q |
116 |
ttacctgaactgcttctttaggaaaagggtttctagcataactgtgaatggtatgattgcaagttttgtcatctacaaaa |
195 |
Q |
| |
|
||||||||| || ||||||||||||| |||||||| ||| ||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
40412240 |
ttacctgaattgtttctttaggaaaatggtttctaacattactgtgaatggtatgatcgcaagttttgtcatctgcaaaa |
40412319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University