View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_low_114 (Length: 251)
Name: NF5654_2D_low_114
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_low_114 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 5 - 240
Target Start/End: Complemental strand, 2674804 - 2674569
Alignment:
| Q |
5 |
accaacattggaggagtgtttggaggttgctgttgaaaagtttgaactagctggagcttctacaactgacattggtgtcatgataaagaaccattgttct |
104 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2674804 |
accaacatgggaggagtgtttggaggttgctgttgaaaagtttgaactagctggagcttctacaactgacattggtgtcatgataaagaaccattgttct |
2674705 |
T |
 |
| Q |
105 |
aatgaaacagcaatggaaggtacgggttgcgtgaacagtatcaactgttgtgtatttatcagataccttttaagtttcaaatattttagggaactaacca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2674704 |
aatgaaacagcaatggaaggtacgggttgcgtaaacattatcaactgttgtgtatttatcagataccttttaagtttcaaatattttagggaactaacca |
2674605 |
T |
 |
| Q |
205 |
accaattttcatcattacagggttcaaaattgatga |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2674604 |
accaattttcatcattacagggttcaaaattgatga |
2674569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University