View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_low_115 (Length: 251)
Name: NF5654_2D_low_115
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_low_115 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 20334064 - 20333900
Alignment:
| Q |
1 |
ccgacacaaaattcgactatgatatagtttctttggtgggatcaacaacagaaatagcaacaaagtttttagggggaagtcataggttctgggctctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20334064 |
ccgacacaaaattcgactatgatatagtttctttggtgggatcaacaacagaaatagcaacaaagtttttagggggaagtcataggttctgggctctttt |
20333965 |
T |
 |
| Q |
101 |
ctttagagggggacacatgaacattctcatcagtagtgtcaccaacaacagcattaacaagacta |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20333964 |
ctttagagggggacacatgaacattctcatcagtagtgtcaccaacaacaacattaacaagacta |
20333900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 235
Target Start/End: Complemental strand, 9738737 - 9738674
Alignment:
| Q |
172 |
attgatttaagacgagcaacgagagcaaaagtctcatcagaatcagctccttctatttgagtgt |
235 |
Q |
| |
|
||||||| |||||||||||| |||| ||| ||||||||| ||| | ||||||| |||||||||| |
|
|
| T |
9738737 |
attgattcaagacgagcaacaagagaaaaggtctcatcaaaataaactccttcaatttgagtgt |
9738674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University