View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_low_117 (Length: 249)
Name: NF5654_2D_low_117
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_low_117 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 23 - 229
Target Start/End: Complemental strand, 6281927 - 6281721
Alignment:
| Q |
23 |
atgcctcaagaaattcagcatacaaaagcagataagatgataactagctttgacaacctcatgttcttggatagtggtgttgaaagaacagagaaagaat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6281927 |
atgcctcaagaaattcagcatacaaaagcagataagatgataactagctttgacaacctcatgttcttggatagtggtgttgaaagaacagagaaagaat |
6281828 |
T |
 |
| Q |
123 |
ttgaaaagttatgcaaatgttctggattttctagttttgaggttgtttgtcttgccttttctgccctaggagtgatggaattttctaaataaataagcaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6281827 |
ttgaaaagttatgcaaatgttctggattttctagttttgaggttgtttgtcttgccttttctgccctaggagtgatggaattttctaaataaataagcaa |
6281728 |
T |
 |
| Q |
223 |
gtattat |
229 |
Q |
| |
|
||||||| |
|
|
| T |
6281727 |
gtattat |
6281721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 103 - 205
Target Start/End: Complemental strand, 6277492 - 6277390
Alignment:
| Q |
103 |
tgaaagaacagagaaagaatttgaaaagttatgcaaatgttctggattttctagttttgaggttgtttgtcttgccttttctgccctaggagtgatggaa |
202 |
Q |
| |
|
|||||||||| ||||||||||||| | || |||||| | |||||||||||||||||||| ||||||| | || |||||| | | |||||||||||| |
|
|
| T |
6277492 |
tgaaagaacaaagaaagaatttgagagtttgtgcaaaagctctggattttctagttttgaaattgtttgcttggctttttcttctttgggagtgatggaa |
6277393 |
T |
 |
| Q |
203 |
ttt |
205 |
Q |
| |
|
||| |
|
|
| T |
6277392 |
ttt |
6277390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University