View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_low_121 (Length: 244)
Name: NF5654_2D_low_121
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_low_121 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 53744444 - 53744309
Alignment:
| Q |
1 |
ttgtagttgttgttcttggatctagctaaggagattatgaaattagtgatgataagtgttgttttcaaggattgattgaagttcaatttgtgaattgctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53744444 |
ttgtagttgttgttcttggatctagctaaggagattatgaaattagtgatgataagtgttgttttcaaggattgattgaagttcaatttgtgaattgctg |
53744345 |
T |
 |
| Q |
101 |
ctgcatgtgtttttgttgttcaatttttgttcttca |
136 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
53744344 |
ccgcatgtgtttttgttgttcaatttttgtttttca |
53744309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 128 - 222
Target Start/End: Original strand, 53744507 - 53744601
Alignment:
| Q |
128 |
tgttcttcactcatgagttgctggagtctttctttaagagcaggaccatgccggccgccgctacgagcattgatgaaaacaaccataggagaagt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53744507 |
tgttcttcactcatgagttgctggagtctttctttaagagcaggaccatgccggccgccgctacgagcattgatgaaaacaaccataggagaagt |
53744601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University