View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_low_138 (Length: 232)
Name: NF5654_2D_low_138
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_low_138 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 39 - 221
Target Start/End: Original strand, 38269371 - 38269553
Alignment:
| Q |
39 |
gactgtactgcagtcgtttatgtatggaccttctgatcaagattggacagtttagatgtgctgactgcatacagtaagactgcactgaatccaaatcttt |
138 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38269371 |
gactgtactgcagtcgtttacgtatggaccttctgatcaagattggacagtttagatgtgctgactgcatacagtaagactgcactgaatccaaatcttt |
38269470 |
T |
 |
| Q |
139 |
aaataccaccatttggttttataaggatattgcattgccaagtatacgtgtgctctctatgcagactaccttggttatgatgt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38269471 |
aaataccaccatttggttttataaggatattacattgccaagtatacgtgtgctctctatgcacactaccttggttatgatgt |
38269553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 38269301 - 38269341
Alignment:
| Q |
1 |
atatatatgtctcatcaagcatgtctagttttataccggac |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38269301 |
atatatatgtctcatcaagcatgtctagttttataccggac |
38269341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University