View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5654_2D_low_138 (Length: 232)

Name: NF5654_2D_low_138
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5654_2D_low_138
NF5654_2D_low_138
[»] chr4 (2 HSPs)
chr4 (39-221)||(38269371-38269553)
chr4 (1-41)||(38269301-38269341)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 39 - 221
Target Start/End: Original strand, 38269371 - 38269553
Alignment:
39 gactgtactgcagtcgtttatgtatggaccttctgatcaagattggacagtttagatgtgctgactgcatacagtaagactgcactgaatccaaatcttt 138  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38269371 gactgtactgcagtcgtttacgtatggaccttctgatcaagattggacagtttagatgtgctgactgcatacagtaagactgcactgaatccaaatcttt 38269470  T
139 aaataccaccatttggttttataaggatattgcattgccaagtatacgtgtgctctctatgcagactaccttggttatgatgt 221  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||    
38269471 aaataccaccatttggttttataaggatattacattgccaagtatacgtgtgctctctatgcacactaccttggttatgatgt 38269553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 38269301 - 38269341
Alignment:
1 atatatatgtctcatcaagcatgtctagttttataccggac 41  Q
    |||||||||||||||||||||||||||||||||||||||||    
38269301 atatatatgtctcatcaagcatgtctagttttataccggac 38269341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University