View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_low_154 (Length: 215)
Name: NF5654_2D_low_154
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_low_154 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 4 - 198
Target Start/End: Complemental strand, 29624402 - 29624209
Alignment:
| Q |
4 |
tatattgtggttttgatgaaattggttcccttttattgatgaaatagaaagttgttcttgatttttgatttattttgttttgatgacagatgagaaattt |
103 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29624402 |
tatattgtggttttgatgaaattgattcccttttatggatgaaatagaaagttgttctt-atttttgatttattttgttttgatgacagatgataaattt |
29624304 |
T |
 |
| Q |
104 |
tcaagctttggaaataatagtatcgttgtatgcttgtattacaagtttgataaataattaggggaggaagtcattgaaactcttgtgtatgatgt |
198 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29624303 |
tcaagctttggaaataatagtatcattgtatgcttgtattacaagtttgataaataattaggggaggaagtaattgaaactcttgtgtatgatgt |
29624209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University