View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_low_157 (Length: 209)
Name: NF5654_2D_low_157
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_low_157 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 10508829 - 10508649
Alignment:
| Q |
1 |
ttgtgaatcaggtaaactttagattaatggattggacgtcatcatcgattcttatgttgttaatcccaaatagcgagtgggctgttgcgccaaaccccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10508829 |
ttgtgaatcaggtaaactttagattaatggattggatgtcatc---gattctaatgttgttaatcccaaatagcgagtgggttgttgcgccaaaccccaa |
10508733 |
T |
 |
| Q |
101 |
aactatagttgtatagtagatagcggaaaaaccactatattgcaaagtcactattgtcaatcttggatagcggagcacagttatgc |
186 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10508732 |
aactatagtggtatagtagatagcggaaaaaccac--tattgcaaagtcactattgtcaatcttggatagtggagcacagttatgc |
10508649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 6 - 67
Target Start/End: Complemental strand, 10546771 - 10546710
Alignment:
| Q |
6 |
aatcaggtaaactttagattaatggattggacgtcatcatcgattcttatgttgttaatccc |
67 |
Q |
| |
|
|||||||| ||||||||||||||||||| || |||||||| ||| ||||||||||||||| |
|
|
| T |
10546771 |
aatcaggtgaactttagattaatggatttgaggtcatcatattttcatatgttgttaatccc |
10546710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 8e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 4 - 74
Target Start/End: Original strand, 33577472 - 33577542
Alignment:
| Q |
4 |
tgaatcaggtaaactttagattaatggattggacgtcatcatcgattcttatgttgttaatcccaaatagc |
74 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33577472 |
tgaatcaggtaaaatttagattaatggattggaggtcatcataaattcttatgttgttaatcccaaatagc |
33577542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 4 - 74
Target Start/End: Original strand, 33578022 - 33578092
Alignment:
| Q |
4 |
tgaatcaggtaaactttagattaatggattggacgtcatcatcgattcttatgttgttaatcccaaatagc |
74 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
33578022 |
tgaatcaggtaaaatttagattaatggattggaggtcatcataaattcttatgttgttaatcccagatagc |
33578092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University