View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_low_160 (Length: 204)
Name: NF5654_2D_low_160
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_low_160 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 53744420 - 53744601
Alignment:
| Q |
1 |
ctagatccaagaacaacaactacaatttcacgatcaactctgttgagtaacagaaattgaaattacagagcaagagcgaggagtacctgttcttcactca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53744420 |
ctagatccaagaacaacaactacaatttcacgatcaactctgttgactgacagaaattgaaattacagagcaagagcgaggagtacctgttcttcactca |
53744519 |
T |
 |
| Q |
101 |
tgagttgctggagtctttctttaagagcaggaccatgccggccgccgctacgagcattgatgaaaacaaccataggagaagt |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53744520 |
tgagttgctggagtctttctttaagagcaggaccatgccggccgccgctacgagcattgatgaaaacaaccataggagaagt |
53744601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University