View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_low_163 (Length: 202)
Name: NF5654_2D_low_163
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_low_163 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 73; Significance: 1e-33; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 105 - 181
Target Start/End: Complemental strand, 151728 - 151652
Alignment:
| Q |
105 |
tagttttagtttaataccactagaagttgaagaagattttcttccaccaaaaactttaacttgttgtccagaaacaa |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
151728 |
tagttttagtttaataccactagaagttgaagaagattttcttctaccaaaaactttaacttgttgtccagaaacaa |
151652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University