View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_low_55 (Length: 465)
Name: NF5654_2D_low_55
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_low_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 6e-72; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 22 - 163
Target Start/End: Complemental strand, 42037472 - 42037331
Alignment:
| Q |
22 |
gtagtataaaacaaattgaaaagaaagaaagtacaaagaagtagggttaatcgtgtatgatgagttcgaactcggtcaccgcatcttttatgattgtgta |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42037472 |
gtagtataaaacaaattgaaaagaaagaaagtacaaagaagtagggttaatcgtgtatgatgagttcgaactcggtcaccacatcttttatgattgtgta |
42037373 |
T |
|
| Q |
122 |
tgtgtgttcaattgagtaagtattggcagctagaccagatac |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42037372 |
tgtgtgttcaattgagtaagtattggcagctagaccagatac |
42037331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 133; E-Value: 6e-69
Query Start/End: Original strand, 217 - 388
Target Start/End: Complemental strand, 42037277 - 42037105
Alignment:
| Q |
217 |
ctctagcaatttcaaaattttgtatcatacaattagagataatttagannnnnnnn-gtaacaaccattgagataatctttcagcctcttcaataagaaa |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42037277 |
ctctagcaatttcaaaattttgtatcatacaattagagatgatttagatttttttttgtaacaaccattgagataatctttcagcctcttcaataagaaa |
42037178 |
T |
|
| Q |
316 |
aatctttcaagttcatcttttgattgaaccttaacattttcaaaataagataatgatatatgttaatattagt |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42037177 |
aatctttcaagttcatcttttgattgaaccttaacattttcaaaataagataatgatatatgttaatactagt |
42037105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 434 - 465
Target Start/End: Complemental strand, 42037111 - 42037080
Alignment:
| Q |
434 |
tactagtaggctgcataaagagaaggtattct |
465 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42037111 |
tactagtaggctgcataaagagaaggtattct |
42037080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University